pBC phagemids (plasmids with a phage origin) are cloning vectors designed to simplify commonly used cloning and sequencing procedures, including the construction of nested deletions for DNA sequencing, generation of RNA Marker/Reporter Enzymes
Agilent pBlueScript II Vectors are powerful cloning vectors for a range of research applications
SnapGene Viewer is free software that allows molecular biologists to create, browse, and share richly annotated sequence files
All the base plasmids are ampicillin resistant except pBC KS- and pCB1520 which are chloramphenicol resistant
Chloramphenicol (CHL) is a bacteriostatic antibiotic that inhibits protein synthesis by binding to the 50S subunit of the bacterial ribosome
Antibiotics were used at the following concentrations: ampicillin 100 μg/mL, chloramphenicol 20 μg/mL, kanamycin 30 or 70 μg/mL, tetracycline 16 μg/mL
Plasmids pHSG398 and pBluescript are vector plasmids that confer resistance to chloramphenicol and tetracycline-ampicillin, respectively
repB’ and replication origin), a chloramphenicol resistance gene and a pBluescript backbone, was
pBluescript II KS (+) and pBluescript
Agilent pBlueScript II Vectors are powerful cloning vectors for a range of research applications
Chloramphenicol: Agilent Technologies: Yes: pBK614: Unspecified: Yes: pBluescript II KS (+) Bacterial Expression: Ampicillin: Stratagene: Yes: pBluescript II KS (-) Bacterial
The vector pBlueScript SK(+) (Stratagene), is a phagemid, which is widely used for in vitro transcription of cloned DNA
Silvestro Conticello
100+ requests (6) 50+ requests (17) 20+ requests (53) Availability to Industry
Annotate features on your plasmids using the curated feature database
The replicon is comprised of the origin of replication ( ori) and all of its control elements
L-Isoleucine, one of the essential amino acids for the human body, has been widely used in medicine, food, and feed industries (Holecek, 2018, Zhang et al
E
Genomic targeting of SNAP tag at Hist1h3g C-terminal
Educational Resources; Plasmids
All the base plasmids are ampicillin resistant except pBC KS- and pCB1520 which are chloramphenicol resistant
For OmpF, OmpC, and PhoE porins
5' end of chloramphenicol resistance gene, reverse primer: CMV Forward: CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer: CRE-R For pBluescript vector: pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector: pBR322ori-F pBluescript vectors: ColE1: 300–500: High copy: pGEM vectors: pMB1* 300–400: High copy: pTZ vectors : pMB1* >1000: High copy: pBR322 and derivatives Cultures of bacteria containing low-copy number plasmids amplified in the presence of chloramphenicol should be treated as if they contain high-copy-number plasmids when choosing the The chloramphenicol resistance gene catD from Clostridium difficile was shown to be encoded on the transposons Tn4453a and Tn4453b, which were structurally and functionally related to Tn4451 from Clostridium perfringens
High Copy Cloning Information
Like pUC vectors, which pBluescript is derived from, there is a multiple cloning site inserted into the LacZ' gene 2
This activity outlines the indications
5 μg/mL for BACs, 25 μg/mL for multicopy plasmids; ampicillin, 25 μg/mL for BACs